Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.024359 |
Chromosome: | chromosome 2 |
Location: | 1606521 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g085050 | COP1,PCOP1 | Plant-type constitutive photomorphogenesis protein 1; (1 of 2) K10143 - E3 ubiquitin-protein ligase RFWD2 (RFWD2, COP1) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAGTTGGACGCCCACCAACGTGCGTGTGAGACGTTCCGTTATTCCACA |
Internal bar code: | TTCGGCTTACATAGATGATGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2427 |
LEAP-Seq percent confirming: | 81.25 |
LEAP-Seq n confirming: | 13 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCCGCATATTTCAGCATGC |
Suggested primer 2: | GCGTCACACCATATGTTCGC |