Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.024408 |
Chromosome: | chromosome 1 |
Location: | 7976479 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g055600 | KIL15 | Putative kinesin-like motor protein; (1 of 2) K10400 - kinesin family member 15 (KIF15) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATGACATAGGCTGCCCCCTCCCCCCCCTCTCTCTCATGCCGTCCTCCTC |
Internal bar code: | TTGATAGCTTTTCTACAGGCAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 49 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTGAGAGCGAGGATTCTCC |
Suggested primer 2: | GTTTGTGTGGCGTTGGTGTT |