Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.024411 |
Chromosome: | chromosome 13 |
Location: | 3859495 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g589500 | PTK9 | Protein tyrosine kinase; (1 of 2) PTHR23257:SF428 - INACTIVE SERINE/THREONINE-PROTEIN KINASE DDB_G0280131-RELATED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTTACAGGGCTCGGTAAGAGCGCCGCCCAAACGCGATGACGTGAATGT |
Internal bar code: | TAGTAGCCCATGTCTGACCTTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1820 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 5 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACAGCTCCAGAATGAGGCAC |
Suggested primer 2: | CGCAAACACACAAGGCATGA |