Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.024436 |
Chromosome: | chromosome 16 |
Location: | 6178523 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g676900 | UAA5 | UDP-galactose transporter; (1 of 2) K15276 - solute carrier family 35 (adenosine 3'-phospho 5'-phosphosulfate transporter), member B2 (SLC35B2, PAPST1) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAGACAGCGAGTGGTGGGCGGCCATGCCCGGGTTATGGCTGCTAACATG |
Internal bar code: | CCAGGCAATCCAACTTTTAGCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1013 |
LEAP-Seq percent confirming: | 92.3077 |
LEAP-Seq n confirming: | 24 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACAAAAGTTTGCCGAGCACC |
Suggested primer 2: | ATTTCTTGAGGACCAGCCCG |