| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.024469 |
| Chromosome: | chromosome 12 |
| Location: | 4229737 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g518100 | FAL16 | Chlamydomonas-specific family protein; (1 of 44) IPR000595 - Cyclic nucleotide-binding domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTGCCAGTACGGGGCTTCTCTAAATCCATGCAAACCTTATGGAATAGC |
| Internal bar code: | GGATTGGTCCCGATCGTTCCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3009 |
| LEAP-Seq percent confirming: | 98.2143 |
| LEAP-Seq n confirming: | 55 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 56 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCAATCCCTGAAAGCCTCT |
| Suggested primer 2: | CTTGGAGGCCCCTGTTACTG |