Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.024490 |
Chromosome: | chromosome 13 |
Location: | 3139830 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g584850 | (1 of 15) 2.5.1.18 - Glutathione transferase / S-(hydroxyalkyl)glutathione lyase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATCTGGGTGCCCCTGCTCGCGACGAGTCAGGAGAACAGCGGAAGTGAGC |
Internal bar code: | CCAGTTAGACAAGTAAATCAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3162 |
LEAP-Seq percent confirming: | 91.1765 |
LEAP-Seq n confirming: | 31 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCAATGTTGTTTGGCTCGGT |
Suggested primer 2: | AAGAGGGGCAGGTAGAGGAG |