Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.024609 |
Chromosome: | chromosome 10 |
Location: | 6744775 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g467050 | MOT48,DAP2,IDA10,DNAA14 | (1 of 3) PF08190 - pre-RNA processing PIH1/Nop17 (PIH1); Inner Arm Dynein assembly factor | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAATTAAGACAACCGAGACGAAGACCGGGGACAAGATCTTCATCAACGTC |
Internal bar code: | GTCTATTGGTAAGCCAGGCGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1296 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGGTGCATGGTGAACCTTTG |
Suggested primer 2: | GACTTAAAGGTGAGGGGGCC |