Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.024781 |
Chromosome: | chromosome 1 |
Location: | 6085380 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g043050 | SNR2 | SNARE-associated Golgi protein; (1 of 2) PTHR12677:SF5 - TVP38/TMEM64 FAMILY MEMBRANE PROTEIN YDJX | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACCCCGCGCCGTGGCCTAGGGCTCAGGCCGTCTGCCAACGCCAGCGTCC |
Internal bar code: | TAATTTGGGGTGGTTTTCATAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4463 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 36 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGGACTTTCCACGTTTGCAC |
Suggested primer 2: | ATGGGGAGCAAAATGGGAGG |