| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.024933 |
| Chromosome: | chromosome 3 |
| Location: | 872874 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g146467 | TRS31 | (1 of 1) IPR007194//IPR016696//IPR024096 - Transport protein particle (TRAPP) component // TRAPP I complex, subunit 5 // NO signalling/Golgi transport ligand-binding domain; Component of TRAPP complex | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCTTTACATTCCAGTCCAGCGCACTCTGGGTTGGTCCCCGTAACCCCC |
| Internal bar code: | GCGTAAGAAACATTTGCCCTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3334 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 55 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 55 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCTCTGTCAACAGCCTGAG |
| Suggested primer 2: | CGGTCCTTGTGAGACACGAA |