| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.025079 |
| Chromosome: | chromosome 17 |
| Location: | 3630084 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g725350 | PSL4,GLC2B | Glucosidase IIb; (1 of 1) K08288 - protein kinase C substrate 80K-H (PRKCSH) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACAGCAGTACCTGCAATTCGGGCGGCTGCCGGCTGCGAGGACGCGGTAG |
| Internal bar code: | TCGCCTGTGCACGATATGGTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3663 |
| LEAP-Seq percent confirming: | 98.1132 |
| LEAP-Seq n confirming: | 52 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 53 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCACGCCCTAAACGCTAATG |
| Suggested primer 2: | GAAGTCCAGGTTGCCGTACA |