Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.025156 |
Chromosome: | chromosome 10 |
Location: | 4003328 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g447350 | SEC23B | (1 of 1) PF04810//PF04811 - Sec23/Sec24 zinc finger (zf-Sec23_Sec24) // Sec23/Sec24 trunk domain (Sec23_trunk); COP-II coat subunit | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGCACGAAGCCGCCGGCCGTGGCGCCCACAGGTGCCGCCGACACGCCGG |
Internal bar code: | TGGAATAAAACGCTCTGCGTTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2442 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 27 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACAACGGGGATGTCTGTGAC |
Suggested primer 2: | GAGCACCTATACAGCGGGTC |