Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.025166 |
Chromosome: | chromosome 16 |
Location: | 2261296 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g658600 | SPC25, SPCB25 | (1 of 1) K11550 - kinetochore protein Spc25, animal type (SPBC25, SPC25); Putative kinetochore protein Spc25 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCGCAACTAGTGCACCCCGTGCATGTGCACACCGAGCCCCACCTGCGG |
Internal bar code: | GACAGTCAGGGACAGTATGACT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2190 |
LEAP-Seq percent confirming: | 57.8947 |
LEAP-Seq n confirming: | 11 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTAAACAACTTGCAGGGCC |
Suggested primer 2: | AAGCAAGATGTGGGCCTACC |