| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.025226 |
| Chromosome: | chromosome 1 |
| Location: | 2816228 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g017400 | (1 of 33) IPR013830 - SGNH hydrolase-type esterase domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGCAAAATCCACCGCCCACCGGCCCGCCGGCTCGACAGGCGCCGACGG |
| Internal bar code: | CCCCAGGGGGGCAGGATGGACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2035 |
| LEAP-Seq percent confirming: | 66.6667 |
| LEAP-Seq n confirming: | 16 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGACGACACCTGCACACATA |
| Suggested primer 2: | CCGACATCGTGATCCTGGAG |