| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.025230 |
| Chromosome: | chromosome 3 |
| Location: | 5875707 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g188400 | RBO2,RBOL2 | (1 of 2) 1.6.3.1 - NAD(P)H oxidase (H(2)O(2)-forming) / Thyroid oxidase 2; Respiratory burst oxidase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAGGTGAGCGTCTTTCGGGCAGGCTGACGGGCAAGTGCAGAGTTGGTAT |
| Internal bar code: | CATGAGTTGCGACCATATCGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3612 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 63 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 63 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATTCGGCTTGCCACATAGC |
| Suggested primer 2: | CGTGCAGTCGTTCTTCAACC |