| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.025239 |
| Chromosome: | chromosome 10 |
| Location: | 6433624 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g464800 | (1 of 22) PTHR11017//PTHR11017:SF145 - LEUCINE-RICH REPEAT-CONTAINING PROTEIN // SUBFAMILY NOT NAMED | intron | |
| Cre10.g801210 | (1 of 68) 2.1.1.43 - Histone-lysine N-methyltransferase / Protein-lysine N-methyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAATTGATACTGGCATAAGTTCACATCCCGTACGGCACACCCGCCCAC |
| Internal bar code: | GGCTCTAGTAGTCGCTTCAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1608 |
| LEAP-Seq percent confirming: | 89.4737 |
| LEAP-Seq n confirming: | 34 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGACTTTCTGTTCCCCGAC |
| Suggested primer 2: | GGAAATACCCCTGGTCCGTG |