Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.025304 |
Chromosome: | chromosome 16 |
Location: | 7214532 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g676981 | (1 of 8) IPR008962 - PapD-like | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGTCCCAACTATGCCACCCTAAGCGGATGCTAAGCTGCTACCCGCTGCA |
Internal bar code: | ATTTCTGTGGACGTCGCGTTCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 6082 |
LEAP-Seq percent confirming: | 91.3043 |
LEAP-Seq n confirming: | 42 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 46 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCCGTCTAGTGGATGTAGC |
Suggested primer 2: | AGAGACGCACAGCATTGACA |