| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.025416 |
| Chromosome: | chromosome 3 |
| Location: | 7716231 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g203600 | GDP6,GDPD6 | Glycerophosphoryl diester phosphodiesterase, probably a phospholipase C; (1 of 1) IPR000909//IPR017946//IPR030395 - Phosphatidylinositol-specific phospholipase C, X domain // PLC-like phosphodiesterase, TIM beta/alpha-barrel domain // Glycerophosphodiester phosphodiesterase domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTAACCATGAATGTAACCCCGCCCCCTCGCCCCCCCGCCCCACAGAACA |
| Internal bar code: | GGGGGTCAATAAATGCGCTCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 479 |
| LEAP-Seq percent confirming: | 50.0 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCATCTCCCTCCTCATGCA |
| Suggested primer 2: | ACCACTTCATTGACGGACCC |