| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.025598 |
| Chromosome: | chromosome 10 |
| Location: | 4107601 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g448450 | UAPA5,XUV2 | (1 of 2) K06901 - putative MFS transporter, AGZA family, xanthine/uracil permease (pbuG); Xanthine/uracil/vitamin C permease-like | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCGTGTATGAGGGCAGCGTTTTGACTTGCTTATTATAAAACACGATGC |
| Internal bar code: | TATGTCACCAGGTCATCCCGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3944 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 86 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 86 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTCGCTTTATTCGTCGCC |
| Suggested primer 2: | GGTGTGGTGGTGAGACAGAG |