Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.025635 |
Chromosome: | chromosome 12 |
Location: | 7736278 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g554650 | REC8 | cohesin complex subunit, putative meiotic isoform; (1 of 3) PF04824 - Conserved region of Rad21 / Rec8 like protein (Rad21_Rec8) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGAACGATGATGAGTGCCGACGTCAAGTTGATGAGAGTGATGCGTTGCAG |
Internal bar code: | AAAAGTTGGCATAGTTCTAGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2820 |
LEAP-Seq percent confirming: | 96.7742 |
LEAP-Seq n confirming: | 30 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGGGGTGCGGTATCAAGTT |
Suggested primer 2: | TGGACTTCGTGTGGTGATGG |