| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.025672 |
| Chromosome: | chromosome 12 |
| Location: | 3648867 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g513400 | EBG1 | Endo-1%252C3(4)-beta-glucanase; (1 of 1) 3.2.1.6 - Endo-1,3(4)-beta-glucanase / Laminarinase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCGATCATTGCCGACGAGATGGCGGCGCTGGAGTCCGCCTCGGCGTCT |
| Internal bar code: | ATTCTCAGTTCAAAGCTCACAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 811 |
| LEAP-Seq percent confirming: | 57.1429 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGGTCGGAAGAAGGAAAGG |
| Suggested primer 2: | TTCACCACAGCCTCCATGTC |