| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.025723 |
| Chromosome: | chromosome 9 |
| Location: | 6379018 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g414550 | CSR7 | Carbohydrate sulfotransferase-related 7; (1 of 1) 2.8.2.33//2.8.2.8 - N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase / GalNAc4S-6ST // [Heparan sulfate]-glucosamine N-sulfotransferase / PAPS:N-desulfoheparin sulfotransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAACACTGGGTGGAACGCTTGTGTGGGGGCGGTGCGTGGCAGGACTGGA |
| Internal bar code: | GGTCGCGGGGACCCGGTACTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3458 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 60 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 60 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTGTCAACCCATGTCGGTG |
| Suggested primer 2: | TATCCATGCCCGCTGTCATC |