| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.025814 |
| Chromosome: | chromosome 2 |
| Location: | 6541686 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g389089 | CNX5,NOFNIR1,NOFNiR,ARC1 | NO-forming nitrite reductase; (1 of 1) PTHR14237:SF30 - MITOCHONDRIAL AMIDOXIME-REDUCING COMPONENT 1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGCCGGGTGGGAATGCGCGGCAAGCGGCAACCTGACACGCAACTTCACA |
| Internal bar code: | TAAATGTAATGAGAAGGACATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1832 |
| LEAP-Seq percent confirming: | 95.2381 |
| LEAP-Seq n confirming: | 20 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTTGTCATCATCGTCCGCA |
| Suggested primer 2: | GCTGCAGCTGGTATCGATCT |