| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.025830 |
| Chromosome: | chromosome 9 |
| Location: | 2799101 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g801024 | (1 of 30) PF00078//PF03372 - Reverse transcriptase (RNA-dependent DNA polymerase) (RVT_1) // Endonuclease/Exonuclease/phosphatase family (Exo_endo_phos) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCCCGGCGTAGGTACGCGCAGATGGGCAGTAGAGGATGCACAGACGCAG |
| Internal bar code: | CAACATTGAGGAGCTCACACAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4970 |
| LEAP-Seq percent confirming: | 7.9646 |
| LEAP-Seq n confirming: | 9 |
| LEAP-Seq n nonconfirming: | 104 |
| LEAP-Seq n unique pos: | 113 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCCGAAACGTCACCCTTCT |
| Suggested primer 2: | GCAAAGTGCTATACCGTGCG |