Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.025937 |
Chromosome: | chromosome 2 |
Location: | 7630567 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g147800 | SEC14 | (1 of 13) IPR001251//IPR011074 - CRAL-TRIO lipid binding domain // CRAL/TRIO, N-terminal domain; Putative phosphoglyceride transfer protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATAGTGAATGTGCGCGAGTCCGAAAACGCAGGAAGGGATGGGCGCCCCC |
Internal bar code: | CGGTGCGGTGACTTCGCTCCGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 712 |
LEAP-Seq percent confirming: | 83.3333 |
LEAP-Seq n confirming: | 10 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTCCCCTTGGTATCCGCAAC |
Suggested primer 2: | TCCTAATTGGCGCTGATGCA |