| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.025949 |
| Chromosome: | chromosome 8 |
| Location: | 994045 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g362050 | FAP49 | (1 of 28) PTHR31600:SF2 - TINY MACROCYSTS PROTEIN B-RELATED; Flagellar Associated Protein 49 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTGCTGGGTCTGGGAATCAGCTGCACCCTACGGGACCTCACCAACCTGC |
| Internal bar code: | GTTGGAATCCATTTGAAAGAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2418 |
| LEAP-Seq percent confirming: | 94.8718 |
| LEAP-Seq n confirming: | 37 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGGGTCTGGCACTTTGTTT |
| Suggested primer 2: | TTGGCCTAGTAACCTGCGTG |