| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.026045 |
| Chromosome: | chromosome 10 |
| Location: | 400563 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g420550 | TSP4,CTPA4,CTPA1 | (1 of 1) IPR004447 - C-terminal-processing peptidase S41A; C-terminal peptidase A | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTAACCCCAGTCCCCTCCAGCCGCCACAAACCCCCCTCCCCAGTCGCC |
| Internal bar code: | GGGGCAGTCGGTAGGGCGGGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1476 |
| LEAP-Seq percent confirming: | 36.3636 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCATCACTGAGGTTCACCA |
| Suggested primer 2: | GCGTCACCACCTTCAACAAC |