| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.026194 |
| Chromosome: | chromosome 12 |
| Location: | 4613499 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g521950 | (1 of 5) K14347 - solute carrier family 10 (sodium/bile acid cotransporter), member 7 (SLC10A7, P7); Sodium:bile acid symporter | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTATCAAGTGGGTGTGTGACTTGGGGGCAGGGGCAGGGGCAGGGACGGG |
| Internal bar code: | TGAATACGGGCTAAGGCTAGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1528 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCACTCACGTAAGGTCCAA |
| Suggested primer 2: | AACGACGTGTCCCTCACTTC |