| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.026231 |
| Chromosome: | chromosome 2 |
| Location: | 6882888 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g388689 | (1 of 1) IPR000719//IPR002290//IPR011009//IPR013785//IPR020635 - Protein kinase domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain // Aldolase-type TIM barrel // Tyrosine-protein kinase, catalytic domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGCAGAAGCGCGGCAGCGTGAACGCGACCTGCGGACCCTCGGACTTGTT |
| Internal bar code: | ACCGTGCTGAGTTGCGAATGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2277 |
| LEAP-Seq percent confirming: | 95.8333 |
| LEAP-Seq n confirming: | 23 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCGCAGTGACCACCATTTA |
| Suggested primer 2: | GCAAATAGGCGCAGGTTAGC |