| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.026291 |
| Chromosome: | chromosome 10 |
| Location: | 3980357 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g801165 | (1 of 1) IPR000104//IPR001965//IPR009057//IPR011011//IPR013083//IPR019787 - Antifreeze protein, type I // Zinc finger, PHD-type // Homeodomain-like // Zinc finger, FYVE/PHD-type // Zinc finger, RING/FYVE/PHD-type // Zinc finger, PHD-finger | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTGAACGTAACCGGTTGTAGTCACGCACACCCATTTTGTCAGCCCGTA |
| Internal bar code: | GTTACTGGCGTATCCTGCCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4343 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 25 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCGCACATGTCAAGAGTCA |
| Suggested primer 2: | CGACGTCAAGCCCGATGATA |