Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.026396 |
Chromosome: | chromosome 4 |
Location: | 2450872 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g221750 | (1 of 88) IPR011333 - POZ domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGGCCAGCTCAACCACCAGTAGTGCTGACGCCGCATCCTTGCTGGGCCA |
Internal bar code: | AATCTCACGCGATCTTCCCACC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1550 |
LEAP-Seq percent confirming: | 76.3158 |
LEAP-Seq n confirming: | 29 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTGGTCACGTGGGTAAGAA |
Suggested primer 2: | GTCCATCCATCAACCTGGCA |