Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.026455 |
Chromosome: | chromosome 15 |
Location: | 1424375 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre15.g641650 | HLM22 | (1 of 4) PTHR10887:SF331 - HELICASE MOV10L1-RELATED; Histone-lysine N-methyltransferase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCACGATCTACGCGATTTGTACCACCCACGTCCCGCCGTGCAGGCGGC |
Internal bar code: | GCAGTGGAGTTACGGTGGGGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 218 |
LEAP-Seq percent confirming: | 16.6667 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTAGGAACTGACACGCACC |
Suggested primer 2: | GACGTTTGGTGTGGTCATGC |