| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.026625 |
| Chromosome: | chromosome 2 |
| Location: | 7958096 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g145250 | RPS27-B,RPS27E2,RPS27e2 | (1 of 2) K02978 - small subunit ribosomal protein S27e (RP-S27e, RPS27); Cytosolic 80S ribosomal protein S27, isoform B | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTGGGGCCATAGCTTGGCGTGGGGCAGGTCACTCTGTTTGGCGGGCAAG |
| Internal bar code: | AGTAACACTTCGGGATCATCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2116 |
| LEAP-Seq percent confirming: | 95.2381 |
| LEAP-Seq n confirming: | 60 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 63 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTCCCTCCAATGCAACGAC |
| Suggested primer 2: | AGTTGGAGCATCGCTTCCAA |