| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.026710 |
| Chromosome: | chromosome 8 |
| Location: | 3117765 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g375900 | EIF2A-1,EIF2Aa,EIF2X | (1 of 1) K15026 - translation initiation factor 2A (EIF2A); Eukaryotic translation initiation factor 2 subunit 1, eIF2-alpha subunit | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCTCCCCACCTACTCCCGCCTCCCCCCCCGCCGCCTCGTCCCGCCTCC |
| Internal bar code: | GTTGACTCGTAGAGCTATTGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1999 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGGAACATGGTTACCGCAG |
| Suggested primer 2: | CATTCATTCACGCCCGTGTC |