| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.026823 |
| Chromosome: | chromosome 3 |
| Location: | 536022 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g145187 | (1 of 274) IPR020683 - Ankyrin repeat-containing domain | 3'UTR_intron | |
| Cre03.g800287 | (1 of 1) PF00665//PF13976 - Integrase core domain (rve) // GAG-pre-integrase domain (gag_pre-integrs) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGGCGCCGCTGGACGGACCAGCGGCACCGTCGGCGGGGTCGGTGTTGT |
| Internal bar code: | GAACGAAAAAGTCAGAAATGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3009 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 69 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 69 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAGACAAGTACAGCTGGGT |
| Suggested primer 2: | GTATACGGGGCAGACGTCAG |