Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.026914 |
Chromosome: | chromosome 7 |
Location: | 1437235 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g323500 | (1 of 1) PF08609 - Nucleotide exchange factor Fes1 (Fes1) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACACCCTCCACCTCACCCTTCAACCCACCTCTCCCAATGCCGCTCCCTC |
Internal bar code: | GCGATTCCCGAATCATTTGTGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 44 |
LEAP-Seq percent confirming: | 7.89474 |
LEAP-Seq n confirming: | 3 |
LEAP-Seq n nonconfirming: | 35 |
LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACAACAGCAACTTCCACGG |
Suggested primer 2: | TCAACCTGACATCTGGCCAC |