| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.026927 |
| Chromosome: | chromosome 3 |
| Location: | 4441985 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g175500 | (1 of 2) K05770 - benzodiazapine receptor (BZRP) | 3'UTR | |
| Cre03.g800331 | CDS | ||
| lncRNA_TCONS_00070774 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGGATGGCGACAGTTGGCTTCGGCTTCTCCAAGACTCATGGCGGCAAGG |
| Internal bar code: | CATATTTGTATAACGCCTGTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2484 |
| LEAP-Seq percent confirming: | 52.1127 |
| LEAP-Seq n confirming: | 37 |
| LEAP-Seq n nonconfirming: | 34 |
| LEAP-Seq n unique pos: | 71 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGAGGCTGTAAGTTGCGCT |
| Suggested primer 2: | CTTGCATTCATACCGTGCGG |