Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.027315 |
Chromosome: | chromosome 16 |
Location: | 1552313 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g653450 | BAR1 | Bin/Amphiphysin/Rvs domain protein 1; (1 of 1) PF03114 - BAR domain (BAR) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACTCGGTCTGGGTGGTTTCCGCTTCCCACACGCTTGACCTTGCCCACCG |
Internal bar code: | TCCCTAATGGGGCAATTGCTGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4243 |
LEAP-Seq percent confirming: | 51.2821 |
LEAP-Seq n confirming: | 40 |
LEAP-Seq n nonconfirming: | 38 |
LEAP-Seq n unique pos: | 78 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGAACGGTAAACATGCGGGA |
Suggested primer 2: | CGCTAGAGTTCTCCGCTCTG |