| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.027365 |
| Chromosome: | chromosome 16 |
| Location: | 3912199 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g689250 | GTR23 | (1 of 1) PF04564//PF06701 - U-box domain (U-box) // Mib_herc2 (MIB_HERC2); Putative ubiquitin-protein ligase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCGTGACACTTCCTCGCTGCCGCCCTATGTCCATGCTTCCACTTTTGCC |
| Internal bar code: | CGCGTAGCGTCATGTTTGGGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3672 |
| LEAP-Seq percent confirming: | 90.9091 |
| LEAP-Seq n confirming: | 40 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 44 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAAATCCCGCCCACTAAGT |
| Suggested primer 2: | ACTTAGTGGGCGGGATTTGG |