Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.027419 |
Chromosome: | chromosome 16 |
Location: | 1238504 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g651000 | RFA3,RPA70B | (1 of 1) PTHR23273:SF4 - REPLICATION PROTEIN A 70 KDA DNA-BINDING SUBUNIT; Replication protein A, 70 kDa DNA-binding subunit | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTTTACAACACGTCAACAGGTGAAGCCCGCCGACAAGAAGTACGTCACC |
Internal bar code: | GTGTTTGTTTAAGTTCAAACAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3844 |
LEAP-Seq percent confirming: | 90.1408 |
LEAP-Seq n confirming: | 64 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 71 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCTCAAGCTCTAGCCCTAC |
Suggested primer 2: | AAACCACCACAAGATTGCGC |