| Insertion cassette: | CIB2 | 
| Side of cassette: | 5' truncated? | 
| Strand: | - | 
| Strain: | CLIP2.027681 | 
| Chromosome: | chromosome 12 | 
| Location: | 3010287 | 
| Confidence (%): | 80 | 
| Locus systematic id | Locus common name | Defline | Feature | 
|---|---|---|---|
| Cre12.g501850 | FFT1 | putative fructan fructosyltransferase; (1 of 2) PTHR31953//PTHR31953:SF1 - FAMILY NOT NAMED // BETA-FRUCTOFURANOSIDASE, INSOLUBLE ISOENZYME CWINV2-RELATED | intron | 
| Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTCCGGAACAACAAGCCACCCTGCAACATCTCTACCCCTCCCCTCCAAT | 
| Internal bar code: | TTATTGTGCTGACCACTCGAAC | 
| Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1403 | 
| LEAP-Seq percent confirming: | 100.0 | 
| LEAP-Seq n confirming: | 2 | 
| LEAP-Seq n nonconfirming: | 0 | 
| LEAP-Seq n unique pos: | 2 | 
| Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCAGATTTCGATACCCGGG | 
| Suggested primer 2: | TATCCACACACAGGTTCCGC |