Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.027722 |
Chromosome: | chromosome 7 |
Location: | 5296045 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g349850 | (1 of 1) IPR000104//IPR001680//IPR017986//IPR020472 - Antifreeze protein, type I // WD40 repeat // WD40-repeat-containing domain // G-protein beta WD-40 repeat | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGAGGCAAGCATCTCAGCATCTTGGGTATGTCGGCAACCCGCGCTTGCGG |
Internal bar code: | AGTCACCACTAAGGGGGCGCCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1498 |
LEAP-Seq percent confirming: | 94.1176 |
LEAP-Seq n confirming: | 16 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTACTGACATCCCTCCCCA |
Suggested primer 2: | CCCTCACACCATCTGCCATT |