Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.027765 |
Chromosome: | chromosome 14 |
Location: | 2606249 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g625150 | PGM8 | (1 of 1) PTHR23029:SF26 - PROTEIN Y18H1A.4-RELATED; Phosphoglycerate mutase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTACTGCCGCTACTGCCGTTGTTTCTACTGCCACTCCCGAAATGCCGGC |
Internal bar code: | TTTCAACACCGCCACAGCTAGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1842 |
LEAP-Seq percent confirming: | 85.7143 |
LEAP-Seq n confirming: | 30 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGAGTGTTGCGAATTGTGC |
Suggested primer 2: | GCATCCACTACGGCAGCTAT |