| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.027807 |
| Chromosome: | chromosome 1 |
| Location: | 100032 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g000650 | AMX2 | (1 of 2) 1.4.3.21 - Primary-amine oxidase / Copper amine oxidase; Copper amine oxidase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTCCGCGCCTCCTTCAGAACCCGCACCCCGTATCTCACCCTGCTCTAC |
| Internal bar code: | GTAATGTTTTTAGAGACATGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2771 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 49 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 49 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAATCTCAATGCCGTCGAC |
| Suggested primer 2: | ACTCCATCCACCTCCCTCTC |