Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.027862 |
Chromosome: | chromosome 2 |
Location: | 5660115 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g115850 | (1 of 3) PF01987 - Mitochondrial biogenesis AIM24 (AIM24) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCACCTGATGAGTGCTTGGGAGGGCCCAAACCACATCATTGCGGCCTGC |
Internal bar code: | CTGTACACTAGGATAATCGCTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3741 |
LEAP-Seq percent confirming: | 73.3333 |
LEAP-Seq n confirming: | 55 |
LEAP-Seq n nonconfirming: | 20 |
LEAP-Seq n unique pos: | 75 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATCTAGCAATCGCGATGCCA |
Suggested primer 2: | CCAGATGCTACCAGCTACGG |