Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.027893 |
Chromosome: | chromosome 12 |
Location: | 13883 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g483500 | (1 of 1) PF06101//PF12624//PF16908//PF16910 - Plant protein of unknown function (DUF946) (DUF946) // N-terminal region of Chorein or VPS13 (Chorein_N) // Vacuolar sorting-associated protein 13, N-terminal (VPS13) // Repeating coiled region of VPS13 (VPS13_mid_rpt) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCGCCTCGCCATACTCGCAGCCGTCAGGCGCAAACGACAGAAACACCT |
Internal bar code: | GTTTTTTATTTCAGCATGTGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2558 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 28 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGACTGTTGCGGAGGTCAAG |
Suggested primer 2: | GGCAAGTAGATGGGCTGTGT |