Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.027975 |
Chromosome: | chromosome 6 |
Location: | 3702031 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g278154 | (1 of 1) PTHR31560:SF0 - UPF0652 PROTEIN | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGACAAGTCCGCACAGCCGGCACGTGTGGCGGACATGTCAGGCCCTGAGC |
Internal bar code: | TGGTTCCAGGGTGCCAATACGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2298 |
LEAP-Seq percent confirming: | 97.9167 |
LEAP-Seq n confirming: | 47 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 48 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGGGTCCGTAGCTAGCATG |
Suggested primer 2: | AAGCAGAGCATCGATACGGG |