Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.028022 |
Chromosome: | chromosome 12 |
Location: | 5111823 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g801421 | (1 of 726) IPR011009 - Protein kinase-like domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTGGCTCGGCCAGCTCGGCAGCCCCTGCAGCCGCCAGCTCGCTGCATGC |
Internal bar code: | GACCAATTCTGTTGTCGAATTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 6206 |
LEAP-Seq percent confirming: | 47.619 |
LEAP-Seq n confirming: | 20 |
LEAP-Seq n nonconfirming: | 22 |
LEAP-Seq n unique pos: | 42 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACGCCAAACAGAGTTGTGG |
Suggested primer 2: | AAGCGCGCAGATTATTGCTG |