| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.028032 |
| Chromosome: | chromosome 2 |
| Location: | 7229466 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g390986 | TSD1 | (1 of 1) PTHR22594//PTHR22594:SF5 - ASPARTYL/LYSYL-TRNA SYNTHETASE // ASPARTATE--TRNA LIGASE, MITOCHONDRIAL; Putative organellar aspartyl-tRNA synthetase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGGCGCCATGCACGCCGATCCCCGCCCCACCCACTCTCACTGTCCCCGG |
| Internal bar code: | AACTTTCGGGTCAAGCTCGTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 785 |
| LEAP-Seq percent confirming: | 8.0 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 23 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGATTTCCGCCAGTCCCATA |
| Suggested primer 2: | TGGCCTCAGATGCAGGAAAG |