| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.028049 |
| Chromosome: | chromosome 14 |
| Location: | 96314 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g608300 | (1 of 6) PTHR13339//PTHR13339:SF0 - COP9 SIGNALOSOME COMPLEX SUBUNIT 8 // COP9 SIGNALOSOME COMPLEX SUBUNIT 8 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCCAGTCGCCCACGCTAGCCCATGCGGGCGTGACGCCCAAAACGTCGCG |
| Internal bar code: | CTCTCTATCCTAAAACAGCCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2898 |
| LEAP-Seq percent confirming: | 90.4762 |
| LEAP-Seq n confirming: | 19 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATAAGGTGGCAGCAGCAGTT |
| Suggested primer 2: | GAAGCAAGCGATAACAGCGG |