Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.028109 |
Chromosome: | chromosome 3 |
Location: | 6505518 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g193850 | SUCLG1,SCLA1,TEF25,SCL1 | (1 of 1) K01899 - succinyl-CoA synthetase alpha subunit (LSC1); Succinyl-CoA ligase alpha chain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTGCGCCCTCCTTCCCGCCCCACCCCCTCCAGGCTGTGTTCCAGACCA |
Internal bar code: | TAGGAAGTGAGGACCGTTCTAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3915 |
LEAP-Seq percent confirming: | 98.1132 |
LEAP-Seq n confirming: | 52 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 53 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGCTAGCACCACAGCGTTTA |
Suggested primer 2: | GCACCTCACAGGGGTACATC |